DNA to mRNA or Aminoacids API

DNA to mRNA or Aminoacids API

DNA to mRNA or Aminoacids API is a service that allows users to convert DNA sequences into their corresponding mRNA and amino acid sequences. This API can be useful for molecular biology research and genetic engineering applications.

API description

About the API:

DNA to mRNA or Aminoacids API is a powerful tool that allows users to easily convert DNA sequences into their corresponding mRNA and amino acid sequences. This API is an essential resource for molecular biology research and genetic engineering applications.

DNA, mRNA, and amino acids are the building blocks of life, and understanding the relationship between them is critical to understanding how living organisms work. The API allows users to input a DNA sequence and convert it into its corresponding mRNA sequence, and then into its corresponding amino acid sequence. This process is called transcription and translation and is a fundamental process in molecular biology and genetic engineering.

The API is user-friendly and easy to use and can be integrated into a variety of applications. It can be used by researchers to analyze genetic data, by biotech companies to design new proteins, and by medical researchers to study genetic diseases. Additionally, it can be used by students to learn about molecular biology and genetics, and by educators to create educational resources.

Overall, the DNA to mRNA or Aminoacids API is an invaluable tool for anyone interested in molecular biology, genetics, and biotechnology. It provides an easy and efficient way to convert DNA sequences into their corresponding mRNA and amino acid sequences, making it an essential resource for research, education, and innovation.

 

What this API receives and what your API provides (input/output)?

Pass the DNA sequence of your choice, and receive the translated sequence for your use. 

 

What are the most common uses cases of this API?

  1. Molecular biology research: The API can be used by researchers to analyze genetic data, such as identifying genes and understanding the function of different proteins.

  2. Genetic engineering: Biotech companies can use the API to design new proteins, such as enzymes or antibodies, by converting DNA sequences into the corresponding amino acid sequences.

  3. Medical research: Medical researchers can use the API to study genetic diseases, such as identifying mutations in genes and understanding how they lead to disease.

  4. Drug development: Pharmaceutical companies can use the API to design new drugs by converting DNA sequences into the corresponding amino acid sequences of target proteins.

  5. Educational resources: Educators can use the API to create educational resources, such as interactive simulations and quizzes that teach students about molecular biology and genetics.

  6. Biotechnology startups: Startups in the field of biotechnology can use the API to develop new products and services, such as diagnostic tests or gene therapy.

 

Are there any limitations to your plans?

Besides API call limitations per month, there are no other limitations.

API Documentation

Endpoints


Convert your DNA sequences to mRNA. 



                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna
                                                                            
                                                                        

DNA to mRNA - Endpoint Features
Object Description
dna [Required] The DNA sequence to transform into an mRNA sequence.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"mRNA":"AUGUUUCCGAUUGCAGGAUCUCGAUAA","dna":"TACAAAGGCTAACGTCCTAGAGCTATT"}
                                                                                                                                                                                                                    
                                                                                                    

DNA to mRNA - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 

    

Transform a DNA sequence into a sequence of Amino Acids

 



                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid
                                                                            
                                                                        

DNA to Amino Acid - Endpoint Features
Object Description
dna [Required] The DNA sequence used for the transformation to Amino Acids
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
                                                                                                                                                                                                                    
                                                                                                    

DNA to Amino Acid - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 

    

Transform an mRNA sequence into a sequence of Amino Acids.

 



                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids
                                                                            
                                                                        

mRNA to Amino Acids - Endpoint Features
Object Description
mRNA [Required] the mRNA sequence used to find the Amino Acid sequence.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
                                                                                                                                                                                                                    
                                                                                                    

MRNA to Amino Acids - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids?mRNA=AUGUUUCCGAUUGCAGGAUCUCGAUAA' --header 'Authorization: Bearer YOUR_API_KEY' 

    

This endpoint transforms an mRNA sequence to its DNA sequence equivalent.

 



                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna
                                                                            
                                                                        

mRNA to DNA - Endpoint Features
Object Description
mRNA [Required] The mRNA sequence as a string of letters.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"mRNA":"UACGUACG","dna":"ATGCATGC"}
                                                                                                                                                                                                                    
                                                                                                    

MRNA to DNA - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna?mRNA=UACGUACG' --header 'Authorization: Bearer YOUR_API_KEY' 

    

API Access Key & Authentication

After signing up, every developer is assigned a personal API access key, a unique combination of letters and digits provided to access to our API endpoint. To authenticate with the DNA to mRNA or Aminoacids API REST API, simply include your bearer token in the Authorization header.

Headers

Header Description
Authorization [Required] Should be Bearer access_key. See "Your API Access Key" above when you are subscribed.


Simple Transparent Pricing

No long term commitments. One click upgrade/downgrade or cancellation. No questions asked.

πŸš€ Enterprise
Starts at $10,000/Year

  • Custom Volume
  • Dedicated account manager
  • Service-level agreement (SLA)

Customer favorite features

  • βœ”οΈŽ Only Pay for Successful Requests
  • βœ”οΈŽ Free 7-Day Trial
  • βœ”οΈŽ Multi-Language Support
  • βœ”οΈŽ One API Key, All APIs.
  • βœ”οΈŽ Intuitive Dashboard
  • βœ”οΈŽ Comprehensive Error Handling
  • βœ”οΈŽ Developer-Friendly Docs
  • βœ”οΈŽ Postman Integration
  • βœ”οΈŽ Secure HTTPS Connections
  • βœ”οΈŽ Reliable Uptime

Zyla API Hub is, in other words, an API MarketPlace. An all-in-one solution for your developing needs. You will be accessing our extended list of APIs with only your user. Also, you won't need to worry about storing API keys, only one API key for all our products is needed.

Prices are listed in USD. We accept all major debit and credit cards. Our payment system uses the latest security technology and is powered by Stripe, one of the world’s most reliable payment companies. If you have any trouble with paying by card, just contact us at [email protected]

Sometimes depending on the bank's fraud protection settings, a bank will decline the validation charge we make when we attempt to be sure a card is valid. We recommend first contacting your bank to see if they are blocking our charges. If more help is needed, please contact [email protected] and our team will investigate further

Prices are based on a recurring monthly subscription depending on the plan selected β€” plus overage fees applied when a developer exceeds a plan’s quota limits. In this example, you'll see the base plan amount as well as a quota limit of API requests. Be sure to notice the overage fee because you will be charged for each additional request.

Zyla API Hub works on a recurring monthly subscription system. Your billing cycle will start the day you purchase one of the paid plans, and it will renew the same day of the next month. So be aware to cancel your subscription beforehand if you want to avoid future charges.

Just go to the pricing page of that API and select the plan that you want to upgrade to. You will only be charged the full amount of that plan, but you will be enjoying the features that the plan offers right away.

Yes, absolutely. If you want to cancel your plan, simply go to your account and cancel on the Billing page. Upgrades, downgrades, and cancellations are immediate.

You can contact us through our chat channel to receive immediate assistance. We are always online from 9 am to 6 pm (GMT+1). If you reach us after that time, we will be in contact when we are back. Also you can contact us via email to [email protected]

 Service Level
100%
 Response Time
165ms

Category:


Tags:


Related APIs