DNA to mRNA or Aminoacids API

DNA to mRNA or Aminoacids API is a service that allows users to convert DNA sequences into their corresponding mRNA and amino acid sequences. This API can be useful for molecular biology research and genetic engineering applications.

About the API:

DNA to mRNA or Aminoacids API is a powerful tool that allows users to easily convert DNA sequences into their corresponding mRNA and amino acid sequences. This API is an essential resource for molecular biology research and genetic engineering applications.

DNA, mRNA, and amino acids are the building blocks of life, and understanding the relationship between them is critical to understanding how living organisms work. The API allows users to input a DNA sequence and convert it into its corresponding mRNA sequence, and then into its corresponding amino acid sequence. This process is called transcription and translation and is a fundamental process in molecular biology and genetic engineering.

The API is user-friendly and easy to use and can be integrated into a variety of applications. It can be used by researchers to analyze genetic data, by biotech companies to design new proteins, and by medical researchers to study genetic diseases. Additionally, it can be used by students to learn about molecular biology and genetics, and by educators to create educational resources.

Overall, the DNA to mRNA or Aminoacids API is an invaluable tool for anyone interested in molecular biology, genetics, and biotechnology. It provides an easy and efficient way to convert DNA sequences into their corresponding mRNA and amino acid sequences, making it an essential resource for research, education, and innovation.

 

What this API receives and what your API provides (input/output)?

Pass the DNA sequence of your choice, and receive the translated sequence for your use. 

 

What are the most common uses cases of this API?

  1. Molecular biology research: The API can be used by researchers to analyze genetic data, such as identifying genes and understanding the function of different proteins.

  2. Genetic engineering: Biotech companies can use the API to design new proteins, such as enzymes or antibodies, by converting DNA sequences into the corresponding amino acid sequences.

  3. Medical research: Medical researchers can use the API to study genetic diseases, such as identifying mutations in genes and understanding how they lead to disease.

  4. Drug development: Pharmaceutical companies can use the API to design new drugs by converting DNA sequences into the corresponding amino acid sequences of target proteins.

  5. Educational resources: Educators can use the API to create educational resources, such as interactive simulations and quizzes that teach students about molecular biology and genetics.

  6. Biotechnology startups: Startups in the field of biotechnology can use the API to develop new products and services, such as diagnostic tests or gene therapy.

 

Are there any limitations to your plans?

Besides API call limitations per month, there are no other limitations.

API Documentation

Endpoints


Convert your DNA sequences to mRNA. 



                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna
                                                                            
                                                                        

DNA to mRNA - Endpoint Features

Object Description
dna [Required] The DNA sequence to transform into an mRNA sequence.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"mRNA":"AUGUUUCCGAUUGCAGGAUCUCGAUAA","dna":"TACAAAGGCTAACGTCCTAGAGCTATT"}
                                                                                                                                                                                                                    
                                                                                                    

DNA to mRNA - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 


    

Transform a DNA sequence into a sequence of Amino Acids

 


                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid
                                                                            
                                                                        

DNA to Amino Acid - Endpoint Features

Object Description
dna [Required] The DNA sequence used for the transformation to Amino Acids
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
                                                                                                                                                                                                                    
                                                                                                    

DNA to Amino Acid - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 


    

Transform an mRNA sequence into a sequence of Amino Acids.

 


                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids
                                                                            
                                                                        

mRNA to Amino Acids - Endpoint Features

Object Description
mRNA [Required] the mRNA sequence used to find the Amino Acid sequence.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
                                                                                                                                                                                                                    
                                                                                                    

MRNA to Amino Acids - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids?mRNA=AUGUUUCCGAUUGCAGGAUCUCGAUAA' --header 'Authorization: Bearer YOUR_API_KEY' 


    

This endpoint transforms an mRNA sequence to its DNA sequence equivalent.

 


                                                                            
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna
                                                                            
                                                                        

mRNA to DNA - Endpoint Features

Object Description
mRNA [Required] The mRNA sequence as a string of letters.
Test Endpoint

API EXAMPLE RESPONSE

       
                                                                                                        
                                                                                                                                                                                                                            {"mRNA":"UACGUACG","dna":"ATGCATGC"}
                                                                                                                                                                                                                    
                                                                                                    

MRNA to DNA - CODE SNIPPETS


curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna?mRNA=UACGUACG' --header 'Authorization: Bearer YOUR_API_KEY' 


    

API Access Key & Authentication

After signing up, every developer is assigned a personal API access key, a unique combination of letters and digits provided to access to our API endpoint. To authenticate with the DNA to mRNA or Aminoacids API REST API, simply include your bearer token in the Authorization header.
Headers
Header Description
Authorization [Required] Should be Bearer access_key. See "Your API Access Key" above when you are subscribed.

Simple Transparent Pricing

No long term commitments. One click upgrade/downgrade or cancellation. No questions asked.

πŸš€ Enterprise

Starts at
$ 10,000/Year


  • Custom Volume
  • Specialized Customer Support
  • Real-Time API Monitoring

Customer favorite features

  • βœ”οΈŽ Only Pay for Successful Requests
  • βœ”οΈŽ Free 7-Day Trial
  • βœ”οΈŽ Multi-Language Support
  • βœ”οΈŽ One API Key, All APIs.
  • βœ”οΈŽ Intuitive Dashboard
  • βœ”οΈŽ Comprehensive Error Handling
  • βœ”οΈŽ Developer-Friendly Docs
  • βœ”οΈŽ Postman Integration
  • βœ”οΈŽ Secure HTTPS Connections
  • βœ”οΈŽ Reliable Uptime

Zyla API Hub is like a big store for APIs, where you can find thousands of them all in one place. We also offer dedicated support and real-time monitoring of all APIs. Once you sign up, you can pick and choose which APIs you want to use. Just remember, each API needs its own subscription. But if you subscribe to multiple ones, you'll use the same key for all of them, making things easier for you.

Prices are listed in USD (United States Dollar), EUR (Euro), CAD (Canadian Dollar), AUD (Australian Dollar), and GBP (British Pound). We accept all major debit and credit cards. Our payment system uses the latest security technology and is powered by Stripe, one of the world’s most reliable payment companies. If you have any trouble paying by card, just contact us at [email protected]

Additionally, if you already have an active subscription in any of these currencies (USD, EUR, CAD, AUD, GBP), that currency will remain for subsequent subscriptions. You can change the currency at any time as long as you don't have any active subscriptions.

The local currency shown on the pricing page is based on the country of your IP address and is provided for reference only. The actual prices are in USD (United States Dollar). When you make a payment, the charge will appear on your card statement in USD, even if you see the equivalent amount in your local currency on our website. This means you cannot pay directly with your local currency.

Occasionally, a bank may decline the charge due to its fraud protection settings. We suggest reaching out to your bank initially to check if they are blocking our charges. Also, you can access the Billing Portal and change the card associated to make the payment. If these does not work and you need further assistance, please contact our team at [email protected]

Prices are determined by a recurring monthly or yearly subscription, depending on the chosen plan.

API calls are deducted from your plan based on successful requests. Each plan comes with a specific number of calls that you can make per month. Only successful calls, indicated by a Status 200 response, will be counted against your total. This ensures that failed or incomplete requests do not impact your monthly quota.

Zyla API Hub works on a recurring monthly subscription system. Your billing cycle will start the day you purchase one of the paid plans, and it will renew the same day of the next month. So be aware to cancel your subscription beforehand if you want to avoid future charges.

To upgrade your current subscription plan, simply go to the pricing page of the API and select the plan you want to upgrade to. The upgrade will be instant, allowing you to immediately enjoy the features of the new plan. Please note that any remaining calls from your previous plan will not be carried over to the new plan, so be aware of this when upgrading. You will be charged the full amount of the new plan.

To check how many API calls you have left for the current month, refer to the β€˜X-Zyla-API-Calls-Monthly-Remaining’ field in the response header. For example, if your plan allows 1000 requests per month and you've used 100, this field in the response header will indicate 900 remaining calls.

To see the maximum number of API requests your plan allows, check the β€˜X-Zyla-RateLimit-Limit’ response header. For instance, if your plan includes 1000 requests per month, this header will display 1000.

The β€˜X-Zyla-RateLimit-Reset’ header shows the number of seconds until your rate limit resets. This tells you when your request count will start fresh. For example, if it displays 3600, it means 3600 seconds are left until the limit resets.

Yes, you can cancel your plan anytime by going to your account and selecting the cancellation option on the Billing page. Please note that upgrades, downgrades, and cancellations take effect immediately. Additionally, upon cancellation, you will no longer have access to the service, even if you have remaining calls left in your quota.

You can contact us through our chat channel to receive immediate assistance. We are always online from 8 am to 5 pm (EST). If you reach us after that time, we will get back to you as soon as possible. Additionally, you can contact us via email at [email protected]

 Service Level
100%
 Response Time
165ms

Category:


Related APIs