DNA to mRNA or Aminoacids API

API ID 965

DNA to mRNA or Aminoacids API is a service that allows users to convert DNA sequences into their corresponding mRNA and amino acid sequences. This API can be useful for molecular biology research and genetic engineering applications.

100% uptime 138 ms avg response

API Documentation

Endpoints

Request

Convert your DNA sequences to mRNA. 

Endpoint ID: 792
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna
INPUT PARAMETERS

DNA to mRNA — Endpoint Features

Object Description
dna Required The DNA sequence to transform into an mRNA sequence.

Free test requests remaining: 3 of 3.


INPUT PARAMETERS

dna
API EXAMPLE RESPONSE
JSON
{"mRNA":"AUGUUUCCGAUUGCAGGAUCUCGAUAA","dna":"TACAAAGGCTAACGTCCTAGAGCTATT"}
DNA to mRNA — CODE SNIPPETS

curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 


    
Request

Transform a DNA sequence into a sequence of Amino Acids

 
Endpoint ID: 793
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid
INPUT PARAMETERS

DNA to Amino Acid — Endpoint Features

Object Description
dna Required The DNA sequence used for the transformation to Amino Acids

Free test requests remaining: 3 of 3.


INPUT PARAMETERS

dna
API EXAMPLE RESPONSE
JSON
{"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
DNA to Amino Acid — CODE SNIPPETS

curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY' 


    
Request

Transform an mRNA sequence into a sequence of Amino Acids.

 
Endpoint ID: 794
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids
INPUT PARAMETERS

mRNA to Amino Acids — Endpoint Features

Object Description
mRNA Required the mRNA sequence used to find the Amino Acid sequence.

Free test requests remaining: 3 of 3.


INPUT PARAMETERS

mRNA
API EXAMPLE RESPONSE
JSON
{"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
MRNA to Amino Acids — CODE SNIPPETS

curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids?mRNA=AUGUUUCCGAUUGCAGGAUCUCGAUAA' --header 'Authorization: Bearer YOUR_API_KEY' 


    
Request

This endpoint transforms an mRNA sequence to its DNA sequence equivalent.

 
Endpoint ID: 795
GET https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna
INPUT PARAMETERS

mRNA to DNA — Endpoint Features

Object Description
mRNA Required The mRNA sequence as a string of letters.

Free test requests remaining: 3 of 3.


INPUT PARAMETERS

mRNA
API EXAMPLE RESPONSE
JSON
{"mRNA":"UACGUACG","dna":"ATGCATGC"}
MRNA to DNA — CODE SNIPPETS

curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna?mRNA=UACGUACG' --header 'Authorization: Bearer YOUR_API_KEY' 


    

API Access Key & Authentication

After signing up, every developer is assigned a personal API access key, a unique combination of letters and digits provided to access to our API endpoint. To authenticate with the DNA to mRNA or Aminoacids API simply include your bearer token in the Authorization header.

Headers
Header Description
Authorization Required Should be Bearer access_key. See "Your API Access Key" above when you are subscribed.

No long-term commitment. Upgrade, downgrade, or cancel anytime. Free Trial includes up to 50 requests.

(Save 2 months with annual billing 🎉)

🚀 Enterprise Plan

Starts at
$ 10,000/Year


  • Custom Volume
  • Custom Rate Limit
  • Specialized Customer Support
  • Real-Time API Monitoring

Overview

About the API:

DNA to mRNA or Aminoacids API is a powerful tool that allows users to easily convert DNA sequences into their corresponding mRNA and amino acid sequences. This API is an essential resource for molecular biology research and genetic engineering applications.

DNA, mRNA, and amino acids are the building blocks of life, and understanding the relationship between them is critical to understanding how living organisms work. The API allows users to input a DNA sequence and convert it into its corresponding mRNA sequence, and then into its corresponding amino acid sequence. This process is called transcription and translation and is a fundamental process in molecular biology and genetic engineering.

The API is user-friendly and easy to use and can be integrated into a variety of applications. It can be used by researchers to analyze genetic data, by biotech companies to design new proteins, and by medical researchers to study genetic diseases. Additionally, it can be used by students to learn about molecular biology and genetics, and by educators to create educational resources.

Overall, the DNA to mRNA or Aminoacids API is an invaluable tool for anyone interested in molecular biology, genetics, and biotechnology. It provides an easy and efficient way to convert DNA sequences into their corresponding mRNA and amino acid sequences, making it an essential resource for research, education, and innovation.

 

What this API receives and what your API provides (input/output)?

Pass the DNA sequence of your choice, and receive the translated sequence for your use. 

 

What are the most common uses cases of this API?

  1. Molecular biology research: The API can be used by researchers to analyze genetic data, such as identifying genes and understanding the function of different proteins.

  2. Genetic engineering: Biotech companies can use the API to design new proteins, such as enzymes or antibodies, by converting DNA sequences into the corresponding amino acid sequences.

  3. Medical research: Medical researchers can use the API to study genetic diseases, such as identifying mutations in genes and understanding how they lead to disease.

  4. Drug development: Pharmaceutical companies can use the API to design new drugs by converting DNA sequences into the corresponding amino acid sequences of target proteins.

  5. Educational resources: Educators can use the API to create educational resources, such as interactive simulations and quizzes that teach students about molecular biology and genetics.

  6. Biotechnology startups: Startups in the field of biotechnology can use the API to develop new products and services, such as diagnostic tests or gene therapy.

 

Are there any limitations to your plans?

Besides API call limitations per month, there are no other limitations.

DNA to mRNA or Aminoacids API FAQs

Each endpoint returns specific biological sequence data. The "DNA to mRNA" endpoint returns the corresponding mRNA sequence, while the "DNA to Amino Acids" and "mRNA to Amino Acids" endpoints return sequences of amino acids. The "mRNA to DNA" endpoint provides the original DNA sequence from the mRNA input.

The key fields include "mRNA" for mRNA sequences, "aminoAcids" which is an array containing details like "letter," "abbreviation," "name," and "type" for each amino acid, and "dna" for the DNA sequence. These fields provide essential information for understanding the biological context.

The response data is structured in JSON format. For amino acids, it includes an array with objects detailing each amino acid's properties. For mRNA and DNA, the response contains a single string representing the sequence. This organization allows for easy parsing and integration into applications.

Each endpoint provides specific conversions: the "DNA to mRNA" endpoint offers the mRNA sequence, the "DNA to Amino Acids" and "mRNA to Amino Acids" endpoints provide amino acid sequences, and the "mRNA to DNA" endpoint returns the original DNA sequence. This functionality supports various biological analyses.

The primary parameter for each endpoint is the DNA or mRNA sequence input. Users can customize their requests by providing valid nucleotide sequences. Each endpoint expects a correctly formatted sequence to ensure accurate conversions.

Users can utilize the returned data for various applications, such as analyzing genetic sequences, designing proteins, or educational purposes. For example, the amino acid sequences can be used in protein modeling, while mRNA sequences can aid in understanding gene expression.

Typical use cases include molecular biology research for gene analysis, genetic engineering for protein design, and medical research for studying genetic diseases. Educators may also use the API to create interactive learning tools for students in genetics.

Data accuracy is maintained through established biological principles of transcription and translation. The API relies on standard genetic codes to ensure that conversions from DNA to mRNA and amino acids are consistent with scientific knowledge, providing reliable outputs for users.

General FAQs

To obtain your API key, first sign in to your account and navigate to the API you want to use. From the API's Pricing section, choose a plan and complete the subscription process. Once subscribed, return to the API page and you will see your API Access Key displayed at the top of the documentation page. You can use this key to authenticate your requests.

You can’t switch APIs during the free trial. If you subscribe to a different API, your trial will end and the new subscription will start as a paid plan.

The free trial lasts for 7 days and allows you to make up to 50 API requests.

No, the free trial is available only once, so we recommend using it on the API that interests you the most. Most of our APIs offer a free trial, but some may not include this option.

Yes. If the API offers a free trial, you will see a "Free 7-Day Trial" option in its Pricing section. The trial lasts for 7 days and allows up to 50 API requests, enabling you to evaluate the API before subscribing to a paid plan.

Zyla API Hub is like a big store for APIs, where you can find thousands of them all in one place. We also offer dedicated support and real-time monitoring of all APIs. Once you sign up, you can pick and choose which APIs you want to use. Just remember, each API needs its own subscription. But if you subscribe to multiple ones, you'll use the same key for all of them, making things easier for you.

Prices are listed in USD (United States Dollar), EUR (Euro), CAD (Canadian Dollar), AUD (Australian Dollar), and GBP (British Pound). We accept all major debit and credit cards. Our payment system uses the latest security technology and is powered by Stripe, one of the world's most reliable payment companies. If you have any trouble paying by card, just contact us at [email protected]

Additionally, if you already have an active subscription in any of these currencies (USD, EUR, CAD, AUD, GBP), that currency will remain for subsequent subscriptions. You can change the currency at any time as long as you don't have any active subscriptions.
The local currency shown on the pricing page is based on the country of your IP address and is provided for reference only. The actual prices are in USD (United States Dollar). When you make a payment, the charge will appear on your card statement in USD, even if you see the equivalent amount in your local currency on our website. This means you cannot pay directly with your local currency.
Occasionally, a bank may decline the charge due to its fraud protection settings. We suggest reaching out to your bank initially to check if they are blocking our charges. Also, you can access the Billing Portal and change the card associated to make the payment. If these does not work and you need further assistance, please contact our team at [email protected]
Prices are determined by a recurring monthly or yearly subscription, depending on the chosen plan.
API calls are deducted from your plan based on successful requests. Each plan comes with a specific number of calls that you can make per month. Only successful calls, indicated by a Status 200 response, will be counted against your total. This ensures that failed or incomplete requests do not impact your monthly quota.
Zyla API Hub works on a recurring monthly subscription system. Your billing cycle will start the day you purchase one of the paid plans, and it will renew the same day of the next month. So be aware to cancel your subscription beforehand if you want to avoid future charges.
To upgrade your current subscription plan, simply go to the pricing page of the API and select the plan you want to upgrade to. The upgrade will be instant, allowing you to immediately enjoy the features of the new plan. Please note that any remaining calls from your previous plan will not be carried over to the new plan, so be aware of this when upgrading. You will be charged the full amount of the new plan.
To check how many API calls you have left for the current month, refer to the 'X-Zyla-API-Calls-Monthly-Remaining' field in the response header. For example, if your plan allows 1,000 requests per month and you've used 100, this field in the response header will indicate 900 remaining calls.

You can monitor your API usage through the response headers included with every request:

x-zyla-api-calls-monthly-used: Shows the total number of API requests you have used during the current billing period.
x-zyla-api-calls-monthly-remaining: Shows the number of API requests you have remaining for the current billing period.

The 'X-Zyla-RateLimit-Reset' header shows the number of seconds until your rate limit resets. This tells you when your request count will start fresh. For example, if it displays 3,600, it means 3,600 seconds are left until the limit resets.

Yes, you can cancel your subscription at any time. Simply go to the Pricing section of the API you're subscribed to and click the "Unsubscribe" button.

Please note that upgrades, downgrades, and cancellations take effect immediately. Once your subscription is canceled, access to the service will end immediately, regardless of any remaining API calls in your quota.

After 7 days, you will be charged the full amount for the plan you were subscribed to during the trial. Therefore, it's important to cancel before the trial period ends. Refund requests for forgetting to cancel on time are not accepted.
When you subscribe to an API free trial, you can make up to 50 API calls. If you wish to make additional API calls beyond this limit, the API will prompt you to perform an "Start Your Paid Plan." You can find the "Start Your Paid Plan" button in your profile under Subscription -> Choose the API you are subscribed to -> Pricing tab.
You can contact us through our chat channel to receive immediate assistance. We are always online from 8 am to 5 pm (EST). If you reach us after that time, we will get back to you as soon as possible. Additionally, you can contact us via email at [email protected]

Please have a look at our Refund Policy: https://zylalabs.com/terms#refund


Related APIs