La API de ADN a ARNm o Aminoácidos es una herramienta poderosa que permite a los usuarios convertir fácilmente secuencias de ADN en sus correspondientes secuencias de ARNm y aminoácidos. Esta API es un recurso esencial para la investigación en biología molecular y aplicaciones de ingeniería genética.
El ADN, el ARNm y los aminoácidos son los bloques de construcción de la vida, y entender la relación entre ellos es crítico para comprender cómo funcionan los organismos vivos. La API permite a los usuarios ingresar una secuencia de ADN y convertirla en su correspondiente secuencia de ARNm, y luego en su correspondiente secuencia de aminoácidos. Este proceso se llama transcripción y traducción y es un proceso fundamental en biología molecular y ingeniería genética.
La API es fácil de usar y puede integrarse en una variedad de aplicaciones. Puede ser utilizada por investigadores para analizar datos genéticos, por empresas biotecnológicas para diseñar nuevas proteínas, y por investigadores médicos para estudiar enfermedades genéticas. Además, puede ser utilizada por estudiantes para aprender sobre biología molecular y genética, y por educadores para crear recursos educativos.
En general, la API de ADN a ARNm o Aminoácidos es una herramienta invaluable para cualquier persona interesada en biología molecular, genética y biotecnología. Proporciona una forma fácil y eficiente de convertir secuencias de ADN en sus correspondientes secuencias de ARNm y aminoácidos, lo que la convierte en un recurso esencial para la investigación, la educación y la innovación.
Proporcione la secuencia de ADN de su elección y reciba la secuencia traducida para su uso.
Investigación en biología molecular: La API puede ser utilizada por investigadores para analizar datos genéticos, como identificar genes y entender la función de diferentes proteínas.
Ingeniería genética: Las empresas biotecnológicas pueden usar la API para diseñar nuevas proteínas, como enzimas o anticuerpos, convirtiendo secuencias de ADN en las correspondientes secuencias de aminoácidos.
Investigación médica: Los investigadores médicos pueden usar la API para estudiar enfermedades genéticas, como identificar mutaciones en genes y entender cómo conducen a la enfermedad.
Desarrollo de medicamentos: Las empresas farmacéuticas pueden usar la API para diseñar nuevos medicamentos convirtiendo secuencias de ADN en las correspondientes secuencias de aminoácidos de proteínas objetivo.
Recursos educativos: Los educadores pueden usar la API para crear recursos educativos, como simulaciones interactivas y cuestionarios que enseñan a los estudiantes sobre biología molecular y genética.
Startups de biotecnología: Las startups en el campo de la biotecnología pueden usar la API para desarrollar nuevos productos y servicios, como pruebas de diagnóstico o terapia génica.
Además de las limitaciones de llamadas a la API por mes, no hay otras limitaciones.
Convierte tus secuencias de ADN a ARN mensajero.
ADN a ARNm - Características del Endpoint
Objeto | Descripción |
---|---|
dna |
[Requerido] The DNA sequence to transform into an mRNA sequence. |
{"mRNA":"AUGUUUCCGAUUGCAGGAUCUCGAUAA","dna":"TACAAAGGCTAACGTCCTAGAGCTATT"}
curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/792/dna+to+mrna?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY'
Transformar una secuencia de ADN en una secuencia de aminoácidos
ADN a Aminoácido - Características del Endpoint
Objeto | Descripción |
---|---|
dna |
[Requerido] The DNA sequence used for the transformation to Amino Acids |
{"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/793/dna+to+amino+acid?dna=TACAAAGGCTAACGTCCTAGAGCTATT' --header 'Authorization: Bearer YOUR_API_KEY'
Transformar una secuencia de ARNm en una secuencia de Aminoácidos.
ARNm a Aminoácidos - Características del Endpoint
Objeto | Descripción |
---|---|
mRNA |
[Requerido] the mRNA sequence used to find the Amino Acid sequence. |
{"aminoAcids":[{"order":0,"letter":"M","abbreviation":"Met","name":"Methionine","type":"Start"},{"order":1,"letter":"F","abbreviation":"Phe","name":"Phenylalanine","type":"Common"},{"order":2,"letter":"P","abbreviation":"Pro","name":"Proline","type":"Common"},{"order":3,"letter":"I","abbreviation":"Ile","name":"Isoleucine","type":"Common"},{"order":4,"letter":"A","abbreviation":"Ala","name":"Alanine","type":"Common"},{"order":5,"letter":"G","abbreviation":"Gly","name":"Glycine","type":"Common"},{"order":6,"letter":"S","abbreviation":"Ser","name":"Serine","type":"Common"},{"order":7,"letter":"R","abbreviation":"Arg","name":"Arginine","type":"Common"},{"order":8,"letter":"Stop","abbreviation":"STOP","name":"Stop","type":"Stop"}]}
curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/794/mrna+to+amino+acids?mRNA=AUGUUUCCGAUUGCAGGAUCUCGAUAA' --header 'Authorization: Bearer YOUR_API_KEY'
Este endpoint transforma una secuencia de ARNm en su secuencia de ADN equivalente.
ARNm a ADN - Características del Endpoint
Objeto | Descripción |
---|---|
mRNA |
[Requerido] The mRNA sequence as a string of letters. |
{"mRNA":"UACGUACG","dna":"ATGCATGC"}
curl --location --request GET 'https://zylalabs.com/api/965/dna+to+mrna+or+aminoacids+api/795/mrna+to+dna?mRNA=UACGUACG' --header 'Authorization: Bearer YOUR_API_KEY'
Encabezado | Descripción |
---|---|
Autorización
|
[Requerido] Debería ser Bearer access_key . Consulta "Tu Clave de Acceso a la API" arriba cuando estés suscrito. |
Sin compromiso a largo plazo. Mejora, reduce o cancela en cualquier momento. La Prueba Gratuita incluye hasta 50 solicitudes.
Cada punto final devuelve datos específicos de secuencias biológicas. El punto final "ADN a ARNm" devuelve la secuencia correspondiente de ARNm, mientras que los puntos finales "ADN a Aminoácidos" y "ARNm a Aminoácidos" devuelven secuencias de aminoácidos. El punto final "ARNm a ADN" proporciona la secuencia original de ADN a partir de la entrada de ARNm.
Los campos clave incluyen "mRNA" para las secuencias de mRNA, "aminoAcids" que es un arreglo que contiene detalles como "letra," "abreviatura," "nombre" y "tipo" para cada aminoácido, y "dna" para la secuencia de ADN. Estos campos proporcionan información esencial para entender el contexto biológico.
Los datos de respuesta están estructurados en formato JSON. Para los aminoácidos, incluye un arreglo con objetos que detallan las propiedades de cada aminoácido. Para el mRNA y el ADN, la respuesta contiene una sola cadena que representa la secuencia. Esta organización permite un fácil análisis e integración en aplicaciones.
Cada punto final proporciona conversiones específicas: el punto final "ADN a ARNm" ofrece la secuencia de ARNm, los puntos finales "ADN a Aminoácidos" y "ARNm a Aminoácidos" proporcionan secuencias de aminoácidos, y el punto final "ARNm a ADN" devuelve la secuencia original de ADN. Esta funcionalidad apoya varios análisis biológicos.
El parámetro principal para cada punto final es la secuencia de ADN o ARN mensajero de entrada. Los usuarios pueden personalizar sus solicitudes proporcionando secuencias de nucleótidos válidas. Cada punto final espera una secuencia formateada correctamente para garantizar conversiones precisas.
Los usuarios pueden utilizar los datos devueltos para diversas aplicaciones, como analizar secuencias genéticas, diseñar proteínas o fines educativos. Por ejemplo, las secuencias de aminoácidos se pueden usar en el modelado de proteínas, mientras que las secuencias de ARN mensajero pueden ayudar a comprender la expresión génica.
Los casos de uso típicos incluyen la investigación en biología molecular para el análisis de genes, la ingeniería genética para el diseño de proteínas y la investigación médica para el estudio de enfermedades genéticas. Los educadores también pueden utilizar la API para crear herramientas de aprendizaje interactivas para estudiantes en genética.
La precisión de los datos se mantiene a través de principios biológicos establecidos de transcripción y traducción. La API se basa en códigos genéticos estándar para asegurar que las conversiones de ADN a ARN mensajero y a aminoácidos sean consistentes con el conocimiento científico, proporcionando resultados confiables para los usuarios.
Zyla API Hub is like a big store for APIs, where you can find thousands of them all in one place. We also offer dedicated support and real-time monitoring of all APIs. Once you sign up, you can pick and choose which APIs you want to use. Just remember, each API needs its own subscription. But if you subscribe to multiple ones, you'll use the same key for all of them, making things easier for you.
Prices are listed in USD (United States Dollar), EUR (Euro), CAD (Canadian Dollar), AUD (Australian Dollar), and GBP (British Pound). We accept all major debit and credit cards. Our payment system uses the latest security technology and is powered by Stripe, one of the world's most reliable payment companies. If you have any trouble paying by card, just contact us at [email protected]
Additionally, if you already have an active subscription in any of these currencies (USD, EUR, CAD, AUD, GBP), that currency will remain for subsequent subscriptions. You can change the currency at any time as long as you don't have any active subscriptions.
The local currency shown on the pricing page is based on the country of your IP address and is provided for reference only. The actual prices are in USD (United States Dollar). When you make a payment, the charge will appear on your card statement in USD, even if you see the equivalent amount in your local currency on our website. This means you cannot pay directly with your local currency.
Occasionally, a bank may decline the charge due to its fraud protection settings. We suggest reaching out to your bank initially to check if they are blocking our charges. Also, you can access the Billing Portal and change the card associated to make the payment. If these does not work and you need further assistance, please contact our team at [email protected]
Prices are determined by a recurring monthly or yearly subscription, depending on the chosen plan.
API calls are deducted from your plan based on successful requests. Each plan comes with a specific number of calls that you can make per month. Only successful calls, indicated by a Status 200 response, will be counted against your total. This ensures that failed or incomplete requests do not impact your monthly quota.
Zyla API Hub works on a recurring monthly subscription system. Your billing cycle will start the day you purchase one of the paid plans, and it will renew the same day of the next month. So be aware to cancel your subscription beforehand if you want to avoid future charges.
To upgrade your current subscription plan, simply go to the pricing page of the API and select the plan you want to upgrade to. The upgrade will be instant, allowing you to immediately enjoy the features of the new plan. Please note that any remaining calls from your previous plan will not be carried over to the new plan, so be aware of this when upgrading. You will be charged the full amount of the new plan.
To check how many API calls you have left for the current month, refer to the 'X-Zyla-API-Calls-Monthly-Remaining' field in the response header. For example, if your plan allows 1.000 requests per month and you've used 100, this field in the response header will indicate 900 remaining calls.
To see the maximum number of API requests your plan allows, check the 'X-Zyla-RateLimit-Limit' response header. For instance, if your plan includes 1.000 requests per month, this header will display 1.000.
The 'X-Zyla-RateLimit-Reset' header shows the number of seconds until your rate limit resets. This tells you when your request count will start fresh. For example, if it displays 3.600, it means 3.600 seconds are left until the limit resets.
Yes, you can cancel your plan anytime by going to your account and selecting the cancellation option on the Billing page. Please note that upgrades, downgrades, and cancellations take effect immediately. Additionally, upon cancellation, you will no longer have access to the service, even if you have remaining calls left in your quota.
You can contact us through our chat channel to receive immediate assistance. We are always online from 8 am to 5 pm (EST). If you reach us after that time, we will get back to you as soon as possible. Additionally, you can contact us via email at [email protected]
To give you the opportunity to experience our APIs without any commitment, we offer a 7-day free trial that allows you to make up to 50 API calls at no cost. This trial can be used only once, so we recommend applying it to the API that interests you the most. While most of our APIs offer a free trial, some may not. The trial concludes after 7 days or once you've made 50 requests, whichever occurs first. If you reach the 50 request limit during the trial, you will need to "Start Your Paid Plan" to continue making requests. You can find the "Start Your Paid Plan" button in your profile under Subscription -> Choose the API you are subscribed to -> Pricing tab. Alternatively, if you don't cancel your subscription before the 7th day, your free trial will end, and your plan will automatically be billed, granting you access to all the API calls specified in your plan. Please keep this in mind to avoid unwanted charges.
After 7 days, you will be charged the full amount for the plan you were subscribed to during the trial. Therefore, it's important to cancel before the trial period ends. Refund requests for forgetting to cancel on time are not accepted.
When you subscribe to an API free trial, you can make up to 50 API calls. If you wish to make additional API calls beyond this limit, the API will prompt you to perform an "Start Your Paid Plan." You can find the "Start Your Paid Plan" button in your profile under Subscription -> Choose the API you are subscribed to -> Pricing tab.
Payout Orders are processed between the 20th and the 30th of each month. If you submit your request before the 20th, your payment will be processed within this timeframe.
Nivel de Servicio:
100%
Tiempo de Respuesta:
376,57ms
Nivel de Servicio:
99%
Tiempo de Respuesta:
1.283,82ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
5.771,76ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.807,52ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
807,08ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
361,30ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
733,81ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
5.919,12ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.496,47ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
10.556,18ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
721,70ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
603,57ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.585,66ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
662,21ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
523,28ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.474,26ms
Nivel de Servicio:
60%
Tiempo de Respuesta:
8.302,14ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.008,22ms
Nivel de Servicio:
75%
Tiempo de Respuesta:
3.159,94ms
Nivel de Servicio:
100%
Tiempo de Respuesta:
1.147,16ms